ID: 1196570479_1196570490

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1196570479 1196570490
Species Human (GRCh38) Human (GRCh38)
Location X:117260976-117260998 X:117261025-117261047
Sequence CCGACCAGCTTAAAAAACGGCGC CTCGGAGGGTCCTACGCCCACGG
Strand - +
Off-target summary {0: 10, 1: 49, 2: 447, 3: 659, 4: 600} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!