ID: 1196613775_1196613783 |
View in Genome Browser |
Spacer: 18 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1196613775 | 1196613783 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | X:117743675-117743697 | X:117743716-117743738 |
Sequence | CCCTCTGGACTCCACACCCAGGC | AGTACCCACTCTCCTGGATTAGG |
Strand | - | + |
Off-target summary | No data | {0: 5, 1: 10, 2: 47, 3: 54, 4: 153} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |