ID: 1196650394_1196650398

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1196650394 1196650398
Species Human (GRCh38) Human (GRCh38)
Location X:118162940-118162962 X:118162984-118163006
Sequence CCAGGTCCTATCCTTGTTCAAAC CACCTAAGCCTGATCTACCAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!