ID: 1196685262_1196685269

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1196685262 1196685269
Species Human (GRCh38) Human (GRCh38)
Location X:118505177-118505199 X:118505220-118505242
Sequence CCATTGCCCGGCTAAGTTTTGTG TTTTGCCATGTTGGCCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 18, 3: 290, 4: 1444} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!