ID: 1196746586_1196746590

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1196746586 1196746590
Species Human (GRCh38) Human (GRCh38)
Location X:119076518-119076540 X:119076552-119076574
Sequence CCAAAAGTCAATTAAAATGTCAA TTTTTGCAAAGAGAGAGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 561} {0: 1, 1: 14, 2: 8, 3: 102, 4: 977}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!