ID: 1196764975_1196764982

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1196764975 1196764982
Species Human (GRCh38) Human (GRCh38)
Location X:119235390-119235412 X:119235415-119235437
Sequence CCCGCCTTTGTCTGGGCTCCAGC AGGGTTATTGTGACTGCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 286} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!