ID: 1196772520_1196772529

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1196772520 1196772529
Species Human (GRCh38) Human (GRCh38)
Location X:119309112-119309134 X:119309158-119309180
Sequence CCTGCTGGATCCGGAGGGATGGA CGGCAAACACCAGTGGTGGATGG
Strand - +
Off-target summary {0: 12, 1: 72, 2: 118, 3: 157, 4: 197} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!