ID: 1196810760_1196810768

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1196810760 1196810768
Species Human (GRCh38) Human (GRCh38)
Location X:119627419-119627441 X:119627465-119627487
Sequence CCAGGAGCCACTGTTCTAATACC GTCATTCCACAGATTGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 94} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!