ID: 1196815807_1196815819 |
View in Genome Browser |
Spacer: 19 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1196815807 | 1196815819 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | X:119664905-119664927 | X:119664947-119664969 |
| Sequence | CCACCTCTCCTCCCTGCCAGGCC | GCCCCAGATGTGCCTCCCCACGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 10, 3: 167, 4: 1229} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||