ID: 1196866779_1196866793

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1196866779 1196866793
Species Human (GRCh38) Human (GRCh38)
Location X:120077784-120077806 X:120077821-120077843
Sequence CCGGATGAGGGAGAGCACGCGTT GGAGGGGTAAGTGGTGTAGTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 0, 4: 47} {0: 2, 1: 0, 2: 0, 3: 15, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!