ID: 1196875105_1196875117

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1196875105 1196875117
Species Human (GRCh38) Human (GRCh38)
Location X:120149555-120149577 X:120149586-120149608
Sequence CCAGGCTCCATCTTTTTAGGCCC CTATGGTCTCTATGGAAATAGGG
Strand - +
Off-target summary No data {0: 2, 1: 7, 2: 3, 3: 17, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!