ID: 1196876299_1196876320

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1196876299 1196876320
Species Human (GRCh38) Human (GRCh38)
Location X:120158447-120158469 X:120158497-120158519
Sequence CCCTCCCCCACACCCTACTACAC AACGCGTGCTCTCCCTCATCCGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 66, 4: 892} {0: 2, 1: 0, 2: 0, 3: 0, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!