ID: 1196876313_1196876321

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1196876313 1196876321
Species Human (GRCh38) Human (GRCh38)
Location X:120158483-120158505 X:120158498-120158520
Sequence CCCCCCACACCACCAACGCGTGC ACGCGTGCTCTCCCTCATCCGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 8, 4: 138} {0: 2, 1: 0, 2: 0, 3: 4, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!