ID: 1196876314_1196876330

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1196876314 1196876330
Species Human (GRCh38) Human (GRCh38)
Location X:120158484-120158506 X:120158535-120158557
Sequence CCCCCACACCACCAACGCGTGCT TGACGCATGCGCACCTCAGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 90} {0: 2, 1: 2, 2: 0, 3: 3, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!