ID: 1196888739_1196888745

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1196888739 1196888745
Species Human (GRCh38) Human (GRCh38)
Location X:120272180-120272202 X:120272211-120272233
Sequence CCCTGTCTGCACCTAGGGCCCTG CTTAGTCACCTGGCTTGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 229} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!