ID: 1196888742_1196888761

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1196888742 1196888761
Species Human (GRCh38) Human (GRCh38)
Location X:120272198-120272220 X:120272250-120272272
Sequence CCCTGAGCATTTGCTTAGTCACC CGGAATCCATGGAGGGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 145} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!