ID: 1196889094_1196889107

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1196889094 1196889107
Species Human (GRCh38) Human (GRCh38)
Location X:120275195-120275217 X:120275240-120275262
Sequence CCACCTTTGTTGATGCTTCCCCT CAGAGTCTGGGGAGGGAAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 21, 3: 279, 4: 1629}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!