ID: 1196923986_1196923990

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1196923986 1196923990
Species Human (GRCh38) Human (GRCh38)
Location X:120613776-120613798 X:120613803-120613825
Sequence CCCACTAGACTCCTTAAATAATG TCTTCTATAAGTGGAATATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104} {0: 1, 1: 0, 2: 0, 3: 18, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!