ID: 1196923986_1196923992

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1196923986 1196923992
Species Human (GRCh38) Human (GRCh38)
Location X:120613776-120613798 X:120613810-120613832
Sequence CCCACTAGACTCCTTAAATAATG TAAGTGGAATATGAGGGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104} {0: 1, 1: 0, 2: 0, 3: 19, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!