ID: 1196942521_1196942525

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1196942521 1196942525
Species Human (GRCh38) Human (GRCh38)
Location X:120791381-120791403 X:120791399-120791421
Sequence CCCTGCTGCAGCATTCTTAGTGG AGTGGCTGCTGGCCAAGAACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!