ID: 1196965411_1196965415

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1196965411 1196965415
Species Human (GRCh38) Human (GRCh38)
Location X:121049140-121049162 X:121049157-121049179
Sequence CCCATTGTACCCACGGCAGAGTT AGAGTTCCAAGACAGTATATCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 1, 4: 65} {0: 1, 1: 1, 2: 0, 3: 10, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!