ID: 1197025260_1197025266

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1197025260 1197025266
Species Human (GRCh38) Human (GRCh38)
Location X:121740237-121740259 X:121740290-121740312
Sequence CCATATTATACCACTGAGTAGAG CTGCATCTGGATTTGGAGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 31, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!