ID: 1197044411_1197044417

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1197044411 1197044417
Species Human (GRCh38) Human (GRCh38)
Location X:121978294-121978316 X:121978338-121978360
Sequence CCTGCCATATTCTGCAGGTAACT CTTGGCCTGTTACTGGGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 209, 3: 184, 4: 209} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!