ID: 1197078296_1197078304

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1197078296 1197078304
Species Human (GRCh38) Human (GRCh38)
Location X:122379061-122379083 X:122379110-122379132
Sequence CCTTCAGTCACTGTGCTCTCCCT ATGCTTCATTGCCACTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 31, 2: 78, 3: 140, 4: 536} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!