ID: 1197132313_1197132328

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1197132313 1197132328
Species Human (GRCh38) Human (GRCh38)
Location X:123019694-123019716 X:123019744-123019766
Sequence CCTGCCTGGCACCACAGGGATCC GGTAAAACTCCACAGGGAAAAGG
Strand - +
Off-target summary No data {0: 3, 1: 69, 2: 87, 3: 83, 4: 373}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!