|
Left Crispr |
Right Crispr |
Crispr ID |
1197132314 |
1197132328 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
X:123019698-123019720
|
X:123019744-123019766
|
Sequence |
CCTGGCACCACAGGGATCCATCA |
GGTAAAACTCCACAGGGAAAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 35, 1: 98, 2: 99, 3: 128, 4: 333} |
{0: 3, 1: 69, 2: 87, 3: 83, 4: 373} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|