ID: 1197157996_1197158000

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1197157996 1197158000
Species Human (GRCh38) Human (GRCh38)
Location X:123291210-123291232 X:123291225-123291247
Sequence CCAGGAACTGAAAAGCCTTGAAG CCTTGAAGGTGCTGGAAGCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!