ID: 1197199073_1197199086

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1197199073 1197199086
Species Human (GRCh38) Human (GRCh38)
Location X:123733133-123733155 X:123733168-123733190
Sequence CCGCCCCACTTTCCTCTCCACCC AGGCAAGGCAGCCAACGACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 172, 4: 1492} {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!