ID: 1197199076_1197199082

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1197199076 1197199082
Species Human (GRCh38) Human (GRCh38)
Location X:123733138-123733160 X:123733153-123733175
Sequence CCACTTTCCTCTCCACCCAGCGG CCCAGCGGAAACCCGAGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 363} {0: 1, 1: 0, 2: 1, 3: 11, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!