ID: 1197264059_1197264074

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1197264059 1197264074
Species Human (GRCh38) Human (GRCh38)
Location X:124347313-124347335 X:124347354-124347376
Sequence CCTCTCTGGATCTGCTGATGTAG TGGGGGGTGGGGAGGGGCAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 63, 3: 769, 4: 5838}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!