ID: 1197280042_1197280046

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1197280042 1197280046
Species Human (GRCh38) Human (GRCh38)
Location X:124524534-124524556 X:124524560-124524582
Sequence CCCTCTTTGGCCTCCTAGTCTAC CACCTCAGATTTAAGATCTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 11, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!