ID: 1197337643_1197337644

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1197337643 1197337644
Species Human (GRCh38) Human (GRCh38)
Location X:125227185-125227207 X:125227207-125227229
Sequence CCAATGCAAACTCTAGTTAATTT TTATGAGTGTATTCTGTATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 198} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!