ID: 1197375873_1197375882

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1197375873 1197375882
Species Human (GRCh38) Human (GRCh38)
Location X:125681689-125681711 X:125681738-125681760
Sequence CCCCAGCAGCAGCCTTGCAGCAC AGTGAGAGTGCAATGACTGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 48, 4: 336} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!