ID: 1197379998_1197380003

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1197379998 1197380003
Species Human (GRCh38) Human (GRCh38)
Location X:125727892-125727914 X:125727937-125727959
Sequence CCTAAGCCCAGTAACAGGCTAAG AGTTTTCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 9, 1: 177, 2: 167, 3: 118, 4: 218} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!