ID: 1197383086_1197383093

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1197383086 1197383093
Species Human (GRCh38) Human (GRCh38)
Location X:125769575-125769597 X:125769599-125769621
Sequence CCAGGTCTCCCCTTCAGGAAGAG CAGTTTGGACTCTGGCTGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 194} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!