ID: 1197392299_1197392304

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1197392299 1197392304
Species Human (GRCh38) Human (GRCh38)
Location X:125882912-125882934 X:125882962-125882984
Sequence CCTAGAGACTTGTTGAATGGTTC CAATGAAGTACAGTCTGAGGTGG
Strand - +
Off-target summary {0: 9, 1: 433, 2: 2088, 3: 2045, 4: 1288} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!