ID: 1197392352_1197392365

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1197392352 1197392365
Species Human (GRCh38) Human (GRCh38)
Location X:125883383-125883405 X:125883425-125883447
Sequence CCCCACTCCCTTGTGCAGCCTCA GCCATGGCTAAAATGGGACAAGG
Strand - +
Off-target summary No data {0: 2, 1: 32, 2: 336, 3: 635, 4: 939}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!