ID: 1197392353_1197392363 |
View in Genome Browser |
Spacer: 12 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1197392353 | 1197392363 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | X:125883384-125883406 | X:125883419-125883441 |
Sequence | CCCACTCCCTTGTGCAGCCTCAG | ACTCCAGCCATGGCTAAAATGGG |
Strand | - | + |
Off-target summary | No data | {0: 7, 1: 110, 2: 692, 3: 1206, 4: 1580} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |