ID: 1197392357_1197392363 |
View in Genome Browser |
Spacer: 5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1197392357 | 1197392363 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | X:125883391-125883413 | X:125883419-125883441 |
| Sequence | CCTTGTGCAGCCTCAGGACTTTG | ACTCCAGCCATGGCTAAAATGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 7, 1: 110, 2: 692, 3: 1206, 4: 1580} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||