ID: 1197409323_1197409326

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1197409323 1197409326
Species Human (GRCh38) Human (GRCh38)
Location X:126096402-126096424 X:126096447-126096469
Sequence CCAAAGCTCAGTAACAGGCAATG AGTTATATGCAGAAGATGGCAGG
Strand - +
Off-target summary No data {0: 4, 1: 197, 2: 189, 3: 119, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!