ID: 1197414995_1197414998

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1197414995 1197414998
Species Human (GRCh38) Human (GRCh38)
Location X:126164739-126164761 X:126164757-126164779
Sequence CCGGCATGGAGTCCAGGCTGGAA TGGAAGAGGCCCTCTCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 256} {0: 1, 1: 0, 2: 1, 3: 23, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!