ID: 1197414995_1197415000

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1197414995 1197415000
Species Human (GRCh38) Human (GRCh38)
Location X:126164739-126164761 X:126164766-126164788
Sequence CCGGCATGGAGTCCAGGCTGGAA CCCTCTCCTCCAGGAACTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 256} {0: 1, 1: 0, 2: 3, 3: 26, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!