ID: 1197420066_1197420072

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1197420066 1197420072
Species Human (GRCh38) Human (GRCh38)
Location X:126227715-126227737 X:126227757-126227779
Sequence CCCTGTATGCTCTGAGTCAGCAT CTCCCATAGCCAGGTTTCACGGG
Strand - +
Off-target summary {0: 3, 1: 71, 2: 102, 3: 102, 4: 206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!