ID: 1197439213_1197439220

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1197439213 1197439220
Species Human (GRCh38) Human (GRCh38)
Location X:126470237-126470259 X:126470281-126470303
Sequence CCTGCAGCATCAGCCATGGCATG AGGGAAAGCATAGTGATTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 232} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!