ID: 1197581428_1197581432 |
View in Genome Browser |
Spacer: 30 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1197581428 | 1197581432 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | X:128288615-128288637 | X:128288668-128288690 |
| Sequence | CCAGCTCAGTCATGGTACAATAG | TCTAGTCCCTGACTCCCAGATGG |
| Strand | - | + |
| Off-target summary | No data | {0: 12, 1: 44, 2: 85, 3: 165, 4: 436} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||