ID: 1197591863_1197591867

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1197591863 1197591867
Species Human (GRCh38) Human (GRCh38)
Location X:128419354-128419376 X:128419394-128419416
Sequence CCCAGTCATCTTCTGCAGATAAC GCAGCTCTTAGCCTGTTACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 17, 2: 193, 3: 207, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!