ID: 1197593820_1197593825

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1197593820 1197593825
Species Human (GRCh38) Human (GRCh38)
Location X:128442894-128442916 X:128442919-128442941
Sequence CCAGTTCTCATTAACTTCCAGTC GAGGAAGGTAGAAAATCCCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!