ID: 1197645151_1197645164

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1197645151 1197645164
Species Human (GRCh38) Human (GRCh38)
Location X:129009487-129009509 X:129009533-129009555
Sequence CCACTTCTCCAGTCCCCTTCTCC CAACAGGCATATAACCAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 131, 4: 1295} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!