ID: 1197645159_1197645164

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1197645159 1197645164
Species Human (GRCh38) Human (GRCh38)
Location X:129009520-129009542 X:129009533-129009555
Sequence CCCCTCCCAGATACAACAGGCAT CAACAGGCATATAACCAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 163} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!