ID: 1197700107_1197700115

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1197700107 1197700115
Species Human (GRCh38) Human (GRCh38)
Location X:129593284-129593306 X:129593336-129593358
Sequence CCCTGATGAATGTGCTGACTCAG CCCAAAGCCTTGGCAGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 150} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!